View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16091_low_133 (Length: 241)

Name: NF16091_low_133
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16091_low_133
NF16091_low_133
[»] chr2 (2 HSPs)
chr2 (24-206)||(7609210-7609392)
chr2 (148-195)||(28559603-28559650)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 206
Target Start/End: Original strand, 7609210 - 7609392
Alignment:
Q  24 gcttctggaaggttatcttttgggttgagatgctggttgttgttcgatgaatatatgttggcaggatagaagggttgtcatgttgtttgtatatttcaaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||    
T  7609210 gcttctggaaggttatcttttgggttgagatgctggttgttgttcgatgaatatatgttggcaggatagaagggttgtcatgttgattgtatattttgaa 7609309  T
Q  124 agttttgggatggtcgtttctttttctcttaagttgttattgtttgatgattgtagagagattttcatccatgtttagttcct 206  Q
    ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  7609310 agttttgggatggtcctttctttttctcttaagttgtttttgtttgatgattgtagagagattttcatccatgtttagttcct 7609392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 195
Target Start/End: Original strand, 28559603 - 28559650
Alignment:
Q  148 tctcttaagttgttattgtttgatgattgtagagagattttcatccat 195  Q
    ||||||||||||||||| |||||||||||||||| ||||| |||||||    
T  28559603 tctcttaagttgttattttttgatgattgtagagggatttccatccat 28559650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University