View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16091_high_160 (Length: 210)

Name: NF16091_high_160
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16091_high_160
NF16091_high_160
[»] chr5 (1 HSPs)
chr5 (1-153)||(17164809-17164961)


Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 17164961 - 17164809
Alignment:
Q  1 atctgtcgattttaccaaacagtgccatactccatacctctaagttacttctgtgggactgtgttactccataccgataagttacttatttgttaggaga 100  Q
    |||||||||||||||||||||||||| ||||||||||| ||||||||||||| || |||||||||||||||| ||| |||||||||||||||||||||||    
T  17164961 atctgtcgattttaccaaacagtgccttactccataccactaagttacttctttgagactgtgttactccattccgctaagttacttatttgttaggaga 17164862  T
Q  101 atttgttatgccattacatattggtggaaatgaaaattttgaaatcacatagg 153  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17164861 atttgttatgccattacatattggtggaaatgaaaattttgaaatcacatagg 17164809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University