View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16091_high_155 (Length: 213)

Name: NF16091_high_155
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16091_high_155
NF16091_high_155
[»] chr2 (1 HSPs)
chr2 (19-190)||(43742216-43742387)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 43742387 - 43742216
Alignment:
Q  19 taggcaattaatgaggaaaatcaaaatatgaccataaattagtctaaatttccagttttcatgacatnnnnnnngatgtagaggaattggcgtttaagat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
T  43742387 taggcaattaatgaggaaaatcaaaatatgaccataaattagtctaaatttccagttttcatgacatgaaaaaagatgtagaggaattggcgtttaagat 43742288  T
Q  119 cggaagacaatgacttagtgggaaaggattagaaaataagggaagagaaagagactgcttgttcaaaccagt 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43742287 cggaagacaatgacttagtgggaaaggattagaaaataagggaagagaaagagactgcttgttcaaaccagt 43742216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University