View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16083_low_10 (Length: 211)

Name: NF16083_low_10
Description: NF16083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16083_low_10
NF16083_low_10
[»] chr1 (1 HSPs)
chr1 (1-192)||(45074295-45074486)
[»] chr2 (1 HSPs)
chr2 (124-181)||(8881170-8881227)
[»] chr7 (1 HSPs)
chr7 (35-111)||(37485237-37485313)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 45074486 - 45074295
Alignment:
Q  1 ttattttcttgcatgatagtatgtactagactaaaccaaagcttcttgcataggcctgcaacggatgtgtcatggctgcccagatttcgctgcgagattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45074486 ttattttcttgcatgatagtatgtactagactaaaccaaagcttcttgcataggcctgcaacggatgtgtcatggctgcccagatttcgctgcgagattt 45074387  T
Q  101 aaccttatccaactattctgacaatgctagttaacaaaactatgttccacagctaacaaattcgtggttggattcatggtttggtaagtata 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45074386 aaccttatccaactattctgacaatgctagttaacaaaactatgttccacagctaacaaattcgtggttggattcatggtttggtaagtata 45074295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 124 - 181
Target Start/End: Complemental strand, 8881227 - 8881170
Alignment:
Q  124 atgctagttaacaaaactatgttccacagctaacaaattcgtggttggattcatggtt 181  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||    
T  8881227 atgctagttaacaaaactatgttccacagctaccaaattcgtggttggatttatggtt 8881170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 111
Target Start/End: Complemental strand, 37485313 - 37485237
Alignment:
Q  35 accaaagcttcttgcataggcctgcaacggatgtgtcatggctgcccagatttcgctgcgagatttaaccttatcca 111  Q
    |||||| ||| |||||||||| ||||| |  ||||||||||||||| ||||||||||| ||||||||||| ||||||    
T  37485313 accaaaactttttgcataggcgtgcaatgattgtgtcatggctgcctagatttcgctgtgagatttaaccatatcca 37485237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University