View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16079_high_1 (Length: 236)

Name: NF16079_high_1
Description: NF16079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16079_high_1
NF16079_high_1
[»] chr6 (1 HSPs)
chr6 (8-94)||(10361745-10361831)
[»] chr2 (1 HSPs)
chr2 (159-218)||(36473888-36473947)


Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 10361745 - 10361831
Alignment:
Q  8 gagaagcaaaggctgcacctgatggaggtgatgttctgggaaccactttaatgactcttacaattttgtattctttgtctcaatata 94  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10361745 gagaagcaatggctgcacctgatggaggtgatgttctgggaaccactttaatgactcttacaattttgtattctttgtctcaatata 10361831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 218
Target Start/End: Original strand, 36473888 - 36473947
Alignment:
Q  159 tgatacggtgggaaaagccagcaaccggtcgctataaatgcaacattgatgtctcgttct 218  Q
    ||||||||||||||||||||| |||||| || |  |||||||||||||||| ||||||||    
T  36473888 tgatacggtgggaaaagccagtaaccgggcgttgcaaatgcaacattgatgcctcgttct 36473947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University