View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16077_low_90 (Length: 263)

Name: NF16077_low_90
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16077_low_90
NF16077_low_90
[»] chr5 (1 HSPs)
chr5 (132-253)||(12274155-12274276)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 132 - 253
Target Start/End: Original strand, 12274155 - 12274276
Alignment:
Q  132 ctaaagttgctatttgaatattgaatgaacactaacatattgcatatttttgcgaacagatgcacgcagaattccaagttctttctccgttggtgtccac 231  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12274155 ctaaaattgctatttgaatattgaatgaacactaacatattgcatatttttgcgaacagatgcacgcagaattccaagttctttctccgttggtgtccac 12274254  T
Q  232 cagagagactcatattcttcga 253  Q
    ||||||||||||| ||||||||    
T  12274255 cagagagactcattttcttcga 12274276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University