View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16077_high_92 (Length: 255)

Name: NF16077_high_92
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16077_high_92
NF16077_high_92
[»] chr3 (1 HSPs)
chr3 (19-243)||(50502425-50502649)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 50502649 - 50502425
Alignment:
Q  19 actacagacgcgtctttgatttaggtaaattcattgcttcacatgttgatacgagtttagatttccattgttgtgtatactctgcttagatacgctgttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||    
T  50502649 actacagacgcgtctttgatttaggtaaattcattgcttcacatgttgatacgagtttagatttccattgttgtgtatactttgcttagacacgctgttt 50502550  T
Q  119 caaatttttgttattgcagcgtgtattgatcacagaggaacacctgaaaaccctgcaagaacttgcactttggaggagaaagaaggggaaatttgcgtaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50502549 caaatttttgttattgcagcgtgtattgatcacagaggaacacctgaaaaccctgcaagaacttgcactttggaggagaaagaaggggaaatttgcgtaa 50502450  T
Q  219 gtttatatttgatttctgtgctgct 243  Q
    |||||||||||||||||||| ||||    
T  50502449 gtttatatttgatttctgtgatgct 50502425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University