View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16076_low_12 (Length: 220)

Name: NF16076_low_12
Description: NF16076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16076_low_12
NF16076_low_12
[»] chr2 (1 HSPs)
chr2 (49-189)||(8386008-8386148)
[»] chr4 (1 HSPs)
chr4 (60-145)||(27978534-27978619)


Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 49 - 189
Target Start/End: Complemental strand, 8386148 - 8386008
Alignment:
Q  49 ctctcttgttggaaaactctatcttcactcacccccaattccggtccactcaatttcagttcacctagtttcaattcacccccaatttcgaattttacat 148  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  8386148 ctctcttgttggaaaactctatcttcactcaccctcaattccggtccactcaatttcagttcacctagtttcaattcatccccaatttcgaattttacat 8386049  T
Q  149 atacttttaagatccccaatttcttagaaactacaacacaa 189  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  8386048 atacttttaagatccccaatttcttagaaactacaacacaa 8386008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 60 - 145
Target Start/End: Complemental strand, 27978619 - 27978534
Alignment:
Q  60 gaaaactctatcttcactcacccccaattccggtccactcaatttcagttcacctagtttcaattcacccccaatttcgaatttta 145  Q
    ||||||||||||||||||||| ||||||| |  || ||  ||||||  ||||||||||||||||| |||| |||||||||||||||    
T  27978619 gaaaactctatcttcactcacacccaatttcaatcaaccaaatttcgattcacctagtttcaattaaccctcaatttcgaatttta 27978534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University