View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16073_high_22 (Length: 231)

Name: NF16073_high_22
Description: NF16073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16073_high_22
NF16073_high_22
[»] chr5 (1 HSPs)
chr5 (156-216)||(4388365-4388425)
[»] chr1 (1 HSPs)
chr1 (18-77)||(44684952-44685011)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 4388365 - 4388425
Alignment:
Q  156 gattgtgacctaacaaatatgaccgaaaggacaacattaattgaattaattaggagctatc 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4388365 gattgtgacctaacaaatatgaccgaaaggacaacattaattgaattaattaggagctatc 4388425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 44685011 - 44684952
Alignment:
Q  18 ttaggtagggttttggtgcttcatttttctatctttagttattaagttatctaaacaaaa 77  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  44685011 ttaggtagggttttggtgcttcatttttctatatttagttattaagttatctaaacaaaa 44684952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University