View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16068_low_96 (Length: 225)

Name: NF16068_low_96
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16068_low_96
NF16068_low_96
[»] chr1 (1 HSPs)
chr1 (1-209)||(45684053-45684261)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 45684053 - 45684261
Alignment:
Q  1 tgtaatgagtctggctttttcaataatgaatttccaaacctgatgttttgattctaaaacagatgcaagttgtagatttaaagagcaccgaagggcccac 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45684053 tgtaatgagtctggctttttcaataatgaattaccaaacctgatgttttgattctaaaacagatgcaagttgtagatttaaagagcaccgaagggcccac 45684152  T
Q  101 tatgatgaattccttcaagttaaagaactgagaaagcaggctgctcttctagagaatggaagtgacaaggagaataatcgtaataccgtgcttgctgagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45684153 tatgatgaattccttcaagttaaagaactgagaaagcaggctgctcttctagagaatggaagtgacaaggagaataatcgtaataccgtgcttgctgagg 45684252  T
Q  201 agaagaaat 209  Q
    |||||||||    
T  45684253 agaagaaat 45684261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University