View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16068_low_76 (Length: 261)

Name: NF16068_low_76
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16068_low_76
NF16068_low_76
[»] chr1 (3 HSPs)
chr1 (18-254)||(17682384-17682620)
chr1 (76-180)||(17665988-17666092)
chr1 (141-177)||(17699134-17699170)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 17682620 - 17682384
Alignment:
Q  18 ttcatcaatttcaaaaggagccccacccctcctttctcgataatcatctccccgtaacggtggctttcatttgctagaaatacgagggatgcggctgcat 117  Q
    |||||||||||||||||| |||| || |||||||  ||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||    
T  17682620 ttcatcaatttcaaaaggggccctactcctccttcttcgatgatcatctccccataacggtcgctttcatttgctagaaatacgagggatgcggctgcat 17682521  T
Q  118 cagaatgatcatccaacgagtcagtacgaaggatggaaatttgttcgcaaatgaaggagacaacgtgcttgtccgctgctatgtcagaaacgaaaagagc 217  Q
    ||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  17682520 cagaacgatcctccaacgagtcagtatgaaggatggaaatttgttcgcaaatgaaggagacaacttgcttgtccgctgctatgtcagaaacgaaaagagc 17682421  T
Q  218 gatggctcttgcagcagtttgttttccttcttctgtg 254  Q
     ||||||||||||||||||||||||||||||| ||||    
T  17682420 aatggctcttgcagcagtttgttttccttcttttgtg 17682384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 180
Target Start/End: Complemental strand, 17666092 - 17665988
Alignment:
Q  76 ggtggctttcatttgctagaaatacgagggatgcggctgcatcagaatgatcatccaacgagtcagtacgaaggatggaaatttgttcgcaaatgaagga 175  Q
    |||||||||||| ||| || || ||||||||||| || || ||||||  ||| ||   |||||| |||||||||||||||||  |||| ||||| |||||    
T  17666092 ggtggctttcatgtgccagtaacacgagggatgcagcggcgtcagaacaatcctctggcgagtcggtacgaaggatggaaatcagttcacaaataaagga 17665993  T
Q  176 gacaa 180  Q
    |||||    
T  17665992 gacaa 17665988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 17699134 - 17699170
Alignment:
Q  141 gtacgaaggatggaaatttgttcgcaaatgaaggaga 177  Q
    |||||||||||||||||| |||| |||||||||||||    
T  17699134 gtacgaaggatggaaattagttcacaaatgaaggaga 17699170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University