View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16068_low_72 (Length: 275)

Name: NF16068_low_72
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16068_low_72
NF16068_low_72
[»] chr2 (1 HSPs)
chr2 (19-262)||(10090307-10090550)


Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 10090550 - 10090307
Alignment:
Q  19 atatagaacttgtagagggtcttcttcaaccttgtgatgcttaggttagcaacatccttcttcacaacatactttgccacaatggatcagtggcttccat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||    
T  10090550 atatagaacttgtagagggtcttcttcaaccttgtgatgcttaggttaacaacatccttcttcacaatatactttgccacaatggatctgtggcttccat 10090451  T
Q  119 atgaaccagcaacagcgacagcctttgcagaaaaatgtcaataacagttactttaagcttaatcaattcttgaatgtcattagaaattaatgataacaat 218  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
T  10090450 atgaaccagcaacagcgacaacctttgcagaaaaatgtcaataacagttactttgagcttaatcaaatcttgaatgtcattagaaattaatgataacaat 10090351  T
Q  219 gagtgcaaaaacataatttaccttgaggataatataccatgttc 262  Q
    |||||||||||||||||||||||||||||||||| |||||||||    
T  10090350 gagtgcaaaaacataatttaccttgaggataataaaccatgttc 10090307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University