View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16068_low_102 (Length: 215)

Name: NF16068_low_102
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16068_low_102
NF16068_low_102
[»] chr1 (1 HSPs)
chr1 (59-197)||(46932534-46932672)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 59 - 197
Target Start/End: Complemental strand, 46932672 - 46932534
Alignment:
Q  59 tagtttctttttagtgaagacattcatggatgaggttgcatttaaattaaacaaaaatgcattcatcatcttacattaaggatgtaattgatttaaaaat 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46932672 tagtttctttttagtgaagacattcatggatgaggttgcatttaaattaaacaaaaatgcattcatcatcttacattaaggatgtaattgatttaaaaat 46932573  T
Q  159 gtaaatatccatcttatactatctactcctgtttccact 197  Q
    |||||||||||||||||||||||||||||||||||||||    
T  46932572 gtaaatatccatcttatactatctactcctgtttccact 46932534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University