View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16065_low_29 (Length: 205)

Name: NF16065_low_29
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16065_low_29
NF16065_low_29
[»] chr4 (2 HSPs)
chr4 (18-116)||(410432-410530)
chr4 (140-190)||(410600-410650)


Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 116
Target Start/End: Original strand, 410432 - 410530
Alignment:
Q  18 gaagaagggtgtgagaatcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa 116  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  410432 gaagaatggtgtgagaatcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa 410530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 190
Target Start/End: Original strand, 410600 - 410650
Alignment:
Q  140 atttgaaattaatgatttatctgttaaccattcaaatgacatttctatttt 190  Q
    ||||||||||||| | |||||||||||||||||||||||||||||||||||    
T  410600 atttgaaattaattagttatctgttaaccattcaaatgacatttctatttt 410650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University