View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1605_low_43 (Length: 226)

Name: NF1605_low_43
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1605_low_43
NF1605_low_43
[»] chr3 (1 HSPs)
chr3 (21-184)||(42297222-42297384)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 184
Target Start/End: Complemental strand, 42297384 - 42297222
Alignment:
Q  21 gataaaatatttcttgatatatatagtattgctctattaaaatagacagaaacatattggagattaaaatctggttgataacttaacgtgtagattttaa 120  Q
    |||||||| ||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42297384 gataaaatctttcttgatatata--gcattgctctattaaaatagacagaaacatattggagattaaaatctggttgataacttaacgtgtagattttaa 42297287  T
Q  121 aataaattgaagaggccgtacc-tttaagtaagttggttagcttcaaattctgaatcatgtgaat 184  Q
    ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||    
T  42297286 aataaattgaagaggtcgtaccttttaagtaagttggttagcttcaaattctgaatcatgtgaat 42297222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University