View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16059_low_3 (Length: 476)

Name: NF16059_low_3
Description: NF16059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16059_low_3
NF16059_low_3
[»] chr3 (1 HSPs)
chr3 (358-440)||(26854889-26854971)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 1e-36; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 26854889 - 26854971
Alignment:
Q  358 cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccactttgacgtatatccacaatct 440  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  26854889 cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccagtttgacgtatatccacaatct 26854971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University