View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16058_high_38 (Length: 202)

Name: NF16058_high_38
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16058_high_38
NF16058_high_38
[»] chr2 (2 HSPs)
chr2 (13-181)||(38633134-38633302)
chr2 (76-181)||(38637182-38637287)
[»] scaffold0370 (1 HSPs)
scaffold0370 (38-106)||(12138-12206)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 9e-72; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 13 - 181
Target Start/End: Original strand, 38633134 - 38633302
Alignment:
Q  13 tagattatactatcttcaaaaggatcggagaaaccgcgtggcgagtaaagagaagatacttatggatttatatatggctcttgatgaattgaatttcatg 112  Q
    ||||||| ||||||| |||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||    
T  38633134 tagattacactatctacaaaaggaacggagaaaccgcgtggcgagtaaggagaagatacttagggatttatatatggctcttgatgagttgaatttcatg 38633233  T
Q  113 aacaaagcatcaaagggaggacggtttggggaaaagcctgataaaaatgttagaaaaatacaggtattt 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||    
T  38633234 aacaaagcatcaaagggaggacggtttggggaaaagcctgataaaaatgttagaaaaatatagctattt 38633302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 76 - 181
Target Start/End: Original strand, 38637182 - 38637287
Alignment:
Q  76 ggatttatatatggctcttgatgaattgaatttcatgaacaaagcatcaaagggaggacggtttggggaaaagcctgataaaaatgttagaaaaatacag 175  Q
    |||||| |||||| |||||||| ||||||||||||| ||||||| | |||| |||| | |||| |||||||||| |||||||||||| ||||||||| ||    
T  38637182 ggatttgtatatgactcttgatcaattgaatttcataaacaaagtagcaaatggagaatggttcggggaaaagcttgataaaaatgtaagaaaaataaag 38637281  T
Q  176 gtattt 181  Q
     |||||    
T  38637282 ctattt 38637287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 106
Target Start/End: Original strand, 12138 - 12206
Alignment:
Q  38 cggagaaaccgcgtggcgagtaaagagaagatacttatggatttatatatggctcttgatgaattgaat 106  Q
    ||||||||| | ||||||| ||||| ||| ||||| | ||||||  |||||||||||||||||||||||    
T  12138 cggagaaacagtgtggcgattaaagggaaaatactaagggattttaatatggctcttgatgaattgaat 12206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University