View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16056_high_55 (Length: 236)

Name: NF16056_high_55
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16056_high_55
NF16056_high_55
[»] chr8 (1 HSPs)
chr8 (1-155)||(40287309-40287461)
[»] chr7 (1 HSPs)
chr7 (93-149)||(3914818-3914874)


Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 40287309 - 40287461
Alignment:
Q  1 acttaaaagtaatgaacacaatattaatttaacgataaattaatcagtaaataacacatatcaaaattgtttctaactccaaaacgtgtccatgagatta 100  Q
    |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||    
T  40287309 acttaaaagtaatgaacacaatattaatttaatgataatttaatcagtaaataaca--tatcaaaattgtttctaactccaaaacgtgtccatgagatta 40287406  T
Q  101 tgaatattttaaaatgttgtttgattatgtcaaatgttactcacttccacccttc 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40287407 tgaatattttaaaatgttgtttgattatgtcaaatgttactcacttccacccttc 40287461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 149
Target Start/End: Complemental strand, 3914874 - 3914818
Alignment:
Q  93 tgagattatgaatattttaaaatgttgtttgattatgtcaaatgttactcacttcca 149  Q
    ||||||||||||||||| ||| || | || |||| |||||||||||||||| |||||    
T  3914874 tgagattatgaatatttcaaattggtcttcgattctgtcaaatgttactcaattcca 3914818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University