View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16055_low_14 (Length: 278)

Name: NF16055_low_14
Description: NF16055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16055_low_14
NF16055_low_14
[»] chr5 (1 HSPs)
chr5 (4-266)||(705000-705264)


Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 266
Target Start/End: Complemental strand, 705264 - 705000
Alignment:
Q  4 gtgtaatggcttacaatttaacgtgtgt--ctgattttcagtttgcaacacataaaaacacctggatgtttagattgatgggacggaatttaaggtcagg 101  Q
    ||||||||||||||||||||||||||||  ||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||    
T  705264 gtgtaatggcttacaatttaacgtgtgtgtctggttttcagtttgtaacacataaaaatacctggatgtttagattgatggggcggaatttaaggtcagg 705165  T
Q  102 tttagcaggttatatgatttatcgttgtttagggggatgtcagtgtttgatatggatgacagatagctttgatcgttggaatcatctaatgttttcaccg 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||    
T  705164 tttagcaggttatatgatttatcgttgtttagggggatgtcagtgtttgatatggatgagagatggctttgatcgttggaatcatctaatgttttcaccg 705065  T
Q  202 ttcgtagtgcttataaatttctctcttttcaacctccgttggaatctccggtggctgtttcatct 266  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||    
T  705064 ttcgtagtgcttataaatttctctcttttcaacttccgttggaatcttcggtggctgtttcatct 705000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University