View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16054_low_55 (Length: 207)

Name: NF16054_low_55
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16054_low_55
NF16054_low_55
[»] chr1 (1 HSPs)
chr1 (21-196)||(41744114-41744288)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 21 - 196
Target Start/End: Complemental strand, 41744288 - 41744114
Alignment:
Q  21 actatctcatttaaatccatattatgtgactatgcacaagaagtaaacatgaattgataagccataagaatagtnnnnnnnnngattatattataaagta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||    
T  41744288 actatctcatttaaatccatattatgtgactatgcacaagaagtaaacatgaattgataagccataagaatagtaaaaaaaa-gattatattataaagta 41744190  T
Q  121 ttaaacctattgatgttaaggctaggctattggatgcaaggttagaattttggttgtccttttaaacctattgatg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41744189 ttaaacctattgatgttaaggctaggctattggatgcaaggttagaattttggttgtccttttaaacctattgatg 41744114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University