View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16054_high_50 (Length: 216)

Name: NF16054_high_50
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16054_high_50
NF16054_high_50
[»] chr1 (2 HSPs)
chr1 (138-201)||(25690398-25690461)
chr1 (34-85)||(25690294-25690345)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 138 - 201
Target Start/End: Original strand, 25690398 - 25690461
Alignment:
Q  138 ccatctctagctttctctttctttgtcacatatcttggcaaagctccatcagatagtatatagt 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25690398 ccatctctagctttctctttctttgtcacatatcttggcaaagctccatcagatagtatatagt 25690461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 25690294 - 25690345
Alignment:
Q  34 actatctttaaattatctacatttcttgaaagttaacctaaaattctgcacc 85  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  25690294 actatctttaaattatctacatttcttgaaagataacctaaaattctgcacc 25690345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University