View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16052_low_26 (Length: 228)

Name: NF16052_low_26
Description: NF16052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16052_low_26
NF16052_low_26
[»] chr8 (1 HSPs)
chr8 (14-227)||(39268857-39269070)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 39268857 - 39269070
Alignment:
Q  14 aatatccatctgcagagaaggtaaataaaaaattatgatttacataatagagcaactttacaaggataaaaataataattaaaaactgaagatcataaat 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  39268857 aatatccatctgcagagaaggtaaataaaaaattatgatttacataatagagcaactttaaaaggataaaaataataattaaaaactgaagatcataaat 39268956  T
Q  114 gaagagaagggtgattgaggatactgacgatgtcctcgagcgaggaaactgaaagatgagcttcccaagtatcagagtggaaattagtgacatgaattac 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39268957 gaagagaagggtgattgaggatactgacgatgtcctcgagcgaggaaactgaaagatgagcttcccaagtatcagagtggaaattagtgacatgaattac 39269056  T
Q  214 aaggtgagaagaat 227  Q
    ||||||||||||||    
T  39269057 aaggtgagaagaat 39269070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University