View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16045_low_15 (Length: 235)

Name: NF16045_low_15
Description: NF16045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16045_low_15
NF16045_low_15
[»] chr4 (1 HSPs)
chr4 (22-183)||(9948941-9949102)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 183
Target Start/End: Original strand, 9948941 - 9949102
Alignment:
Q  22 tgaggattaaatgatgacttcactattgctagactaccggagaagcttctccggtagccggaggaagttaccgtcgatgacacgcttttccggacatgat 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9948941 tgaggattaaatgatgacttcactattgctagactaccggagaagcttctccggtagccggaggaagttaccgtcgatgacacgcttttccggacatgat 9949040  T
Q  122 gaaactgaacaattcttggagattttatacgaagtttcactccaggagaatttacagaacca 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9949041 gaaactgaacaattcttggagattttatacgaagtttcactccaggagaatttacagaacca 9949102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University