View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16044_low_3 (Length: 263)

Name: NF16044_low_3
Description: NF16044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16044_low_3
NF16044_low_3
[»] chr1 (1 HSPs)
chr1 (18-251)||(42516495-42516728)


Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 42516728 - 42516495
Alignment:
Q  18 tggcaagcatattctatgaatcaactaataaaaatgattgatatacaaattattgtgattaattatttgcaataatagagaggctgatttatggaatagt 117  Q
    |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42516728 tggcaagcatattctatgaatcaactaaaataaatgattgatatacaaattattgtgattaattatttgcaataatagagaggctgatttatggaatagt 42516629  T
Q  118 gattgctcctttacaggttaagggtgaggaatgtcagaataattgagcaacaagaaatatcaaacaccctctttgacactcattttcattgcaagacaag 217  Q
    |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  42516628 gattgctcctttacaggtcaagggtgaggaatgtcagaataatcgagcaacaagaaataacaaacaccctctttgacactcattttcattgcaagacaag 42516529  T
Q  218 tctcaatgccagtgtcgaaactaccttcatttct 251  Q
    ||||||||||||||||||||||||||| ||||||    
T  42516528 tctcaatgccagtgtcgaaactaccttgatttct 42516495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University