View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16041_low_21 (Length: 209)

Name: NF16041_low_21
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16041_low_21
NF16041_low_21
[»] chr3 (1 HSPs)
chr3 (1-186)||(44968961-44969145)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 44969145 - 44968961
Alignment:
Q  1 tcatgttaccaatgaaatccaaatagacaaacagagaaatgacatagaaaaagtgaaagggtaataaaaataataatgagtataatgtgaagatgtaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44969145 tcatgttaccaatgaaatccaaatagacaaacagagaaatgacatagaaaaagtgaaagggtaataaaaataataatgagtataatgtgaagatgtaaat 44969046  T
Q  101 taccaagtcgagtgagatgaatgagagctttaatccgattttcatccaatttatggatattatcctctacccatttgccaagaacc 186  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44969045 taccaagtcgag-gacatgaatgagagctttaatccgattttcatccaatttatggatattatcctctacccatttgccaagaacc 44968961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University