View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16041_low_18 (Length: 268)

Name: NF16041_low_18
Description: NF16041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16041_low_18
NF16041_low_18
[»] chr8 (1 HSPs)
chr8 (140-256)||(4492546-4492664)


Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 140 - 256
Target Start/End: Complemental strand, 4492664 - 4492546
Alignment:
Q  140 aatttaaaatagagtaccttgtcatgaagnnnnnnnntgaaggtaagacttttaatagttttgtcatacnnnnnnn--gttgaataaatatagttttgtc 237  Q
    |||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
T  4492664 aatttaaaatagagtaccttgtcatgaagaaaaaaaatgaaggtaagacttttaatagttttgtcatactttttttttgttgaataaatatagttttgtc 4492565  T
Q  238 ctgtttgatattttcttgg 256  Q
    |||||||||||||| ||||    
T  4492564 ctgtttgatatttttttgg 4492546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University