View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16040_low_24 (Length: 237)

Name: NF16040_low_24
Description: NF16040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16040_low_24
NF16040_low_24
[»] chr4 (1 HSPs)
chr4 (161-215)||(39197874-39197928)


Alignment Details
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 161 - 215
Target Start/End: Complemental strand, 39197928 - 39197874
Alignment:
Q  161 atctaaatcacttttcttttcttctccttcactacttgtattctattgaatcacg 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39197928 atctaaatcacttttcttttcttctccttcactacttgtattctattgaatcacg 39197874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University