View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16033_low_16 (Length: 212)

Name: NF16033_low_16
Description: NF16033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16033_low_16
NF16033_low_16
[»] chr4 (1 HSPs)
chr4 (24-152)||(4090024-4090152)
[»] chr6 (1 HSPs)
chr6 (23-128)||(7942269-7942374)
[»] chr8 (1 HSPs)
chr8 (56-89)||(29651731-29651764)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 24 - 152
Target Start/End: Original strand, 4090024 - 4090152
Alignment:
Q  24 gcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcattttc 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4090024 gcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcattttc 4090123  T
Q  124 tcaaaattttactggggtcaacatctcaa 152  Q
    |||||||||||| ||||||||||||||||    
T  4090124 tcaaaattttaccggggtcaacatctcaa 4090152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 128
Target Start/End: Complemental strand, 7942374 - 7942269
Alignment:
Q  23 agcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcatttt 122  Q
    ||||||||||||| ||||  ||||| |||   ||||||| ||| ||||||||||| |||||| ||| | |||| |||||| | |||| |||||||||| |    
T  7942374 agcaccaacacttctgatctaaggtgtgtcgtggtgtccgacacgtgtcagtgtccgacacagcactgacacatgtgattacattgaattatgtcattgt 7942275  T
Q  123 ctcaaa 128  Q
    ||||||    
T  7942274 ctcaaa 7942269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 89
Target Start/End: Original strand, 29651731 - 29651764
Alignment:
Q  56 gtgtccaacatgtgtcagtgtctgacacaacacc 89  Q
    |||||||||||||||||||||||||||| |||||    
T  29651731 gtgtccaacatgtgtcagtgtctgacacgacacc 29651764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University