View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1602_low_60 (Length: 234)

Name: NF1602_low_60
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1602_low_60
NF1602_low_60
[»] chr1 (1 HSPs)
chr1 (104-219)||(3310501-3310615)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 3310615 - 3310501
Alignment:
Q  104 gagcatatatctgctgttttttctctcctccttttggctatatgtttccatgatgttttattccattaacaggtatgcctcctttcctcagatctgattc 203  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3310615 gagcatatatctgctgttttt-ctctcctccttttggctatatgtttccatgatgttttattccattaacaggtatgcctcctttcctcagatctgattc 3310517  T
Q  204 agttattagtattttt 219  Q
    ||||||||||||||||    
T  3310516 agttattagtattttt 3310501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University