View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1602_low_58 (Length: 239)

Name: NF1602_low_58
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1602_low_58
NF1602_low_58
[»] chr1 (2 HSPs)
chr1 (28-112)||(33294330-33294414)
chr1 (181-223)||(33294214-33294256)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 28 - 112
Target Start/End: Complemental strand, 33294414 - 33294330
Alignment:
Q  28 aagaaactaatatggagtgacatagtaatatagtgctagcagaaccatgaagaaaagattaccatcaagggcttcatctttattc 112  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33294414 aagaaactaatatagagtgacatattaatatagtgctagcagaaccatgaagaaaagattaccatcaagggcttcatctttattc 33294330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 33294256 - 33294214
Alignment:
Q  181 aggataaaattgaaaccgtgtgttgatccatttttcatctctg 223  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  33294256 aggataaaattgaaaccgtgtgttgatccatttttcatctctg 33294214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University