View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1602_low_41 (Length: 292)

Name: NF1602_low_41
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1602_low_41
NF1602_low_41
[»] chr6 (1 HSPs)
chr6 (20-285)||(19373684-19373949)


Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 285
Target Start/End: Original strand, 19373684 - 19373949
Alignment:
Q  20 gtcccgcttgggcagcaacgggagaatgtcaacgtaaccctgtctacatggttggatctcctgattactatggtacatgtcggaaaagctgcaatgcatg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19373684 gtcccgcttgggcagcaacgggagaatgtcaacgtaaccctgtctacatggttggatctcctgattactatggtacatgtcggaaaagctgcaatgcatg 19373783  T
Q  120 ctgatgagaagttggttttgcataannnnnnnnacgtggttgcttttttaatttgattggagaataggaacatatagtagagtgaattaactgatattct 219  Q
    |||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19373784 ctgatgagaagttggttttgcataattttttttacgtggttgcttttttaatttgattggagaataggaacatatagtagagtgaattaactgatattct 19373883  T
Q  220 caggatgttcttgagcaactatgatgttcctcaattaactaggcagtatattatttgcctttgctt 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19373884 caggatgttcttgagcaactatgatgttcctcaattaactaggcagtatattatttgcctttgctt 19373949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University