View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16029_high_18 (Length: 278)

Name: NF16029_high_18
Description: NF16029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16029_high_18
NF16029_high_18
[»] chr4 (1 HSPs)
chr4 (69-258)||(46635060-46635231)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 69 - 258
Target Start/End: Original strand, 46635060 - 46635231
Alignment:
Q  69 caatttgcacaaacccataacttagcactgagagagttttgtgggtgatgataattgcaacccaattacaaaccttaaatccccaaattagttttcccca 168  Q
    ||||||||||||||||||  ||||||| | ||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
T  46635060 caatttgcacaaacccatggcttagcagtaagaaagttttgtgggtgatgataattgcaactcaattgcaaaccttaaatccccaaattagttttcccca 46635159  T
Q  169 attttgaatttaaaattgttgtttttgtaatttcaggtgttgtagtgaagaaaagggagaatgaaatgaatttatagggaagatgatgaa 258  Q
    ||||| |||||||||||||||||                  ||||||||||||||||| ||||||||||||||| |||||||||||||||    
T  46635160 attttaaatttaaaattgttgtt------------------gtagtgaagaaaagggataatgaaatgaatttagagggaagatgatgaa 46635231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University