View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16023_low_20 (Length: 288)

Name: NF16023_low_20
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16023_low_20
NF16023_low_20
[»] chr7 (2 HSPs)
chr7 (17-247)||(48567921-48568151)
chr7 (243-273)||(48565571-48565601)


Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 48568151 - 48567921
Alignment:
Q  17 tgtgaacaaatatcaaagtttattatttttacatcaaaaacacatccaataagtgggatctagcaaataagtcaaatttttgttcttttcttatttccat 116  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  48568151 tgtgaaaaaatatcaaagtttattatttttacatcaaaaacacatccaataagtgtgatctagcaaataagtcaaatttttgttcttttcttatttccat 48568052  T
Q  117 tcttaattctgtttacatcatttcaactctcttgaggctttcaaatatgcttggatatctctttcaaattaatcaattttgaatgacctaaaatgttaac 216  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  48568051 tcttaattctgtttaaatcatttcaactctcttgaggctttcaaatatgctcggatatctctttcaaattaatcaattttgaatgacctaaaatgttaac 48567952  T
Q  217 tatagacctgctcttaagtacttataccttg 247  Q
    |||||||||||||||||||||||||||||||    
T  48567951 tatagacctgctcttaagtacttataccttg 48567921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 243 - 273
Target Start/End: Complemental strand, 48565601 - 48565571
Alignment:
Q  243 ccttgtgaagagaggacgaaccagtgacata 273  Q
    |||||||||||||||||||||||||||||||    
T  48565601 ccttgtgaagagaggacgaaccagtgacata 48565571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University