View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16023_high_26 (Length: 238)

Name: NF16023_high_26
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16023_high_26
NF16023_high_26
[»] chr8 (2 HSPs)
chr8 (150-221)||(34218610-34218681)
chr8 (18-89)||(34218477-34218548)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 150 - 221
Target Start/End: Original strand, 34218610 - 34218681
Alignment:
Q  150 gaaatgcctaacgccgaataaatgccatgacatgacaagattaaggctatggttgagagtttattacgttca 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34218610 gaaatgcctaacgccgaataaatgccatgacatgacaagattaaggctatggttgagagtttattacgttca 34218681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 34218477 - 34218548
Alignment:
Q  18 gcaatgtcctaacaacatgtatattacggctactccaataaatttcaccaacttgatctcattcattggttg 89  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34218477 gcaatgccctaacaacatgtatattacggctactccaataaatttcaccaacttgatctcattcattggttg 34218548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University