View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16022_low_18 (Length: 267)

Name: NF16022_low_18
Description: NF16022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16022_low_18
NF16022_low_18
[»] chr4 (1 HSPs)
chr4 (19-217)||(49623779-49623974)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 49623974 - 49623779
Alignment:
Q  19 taacgttgttgagatcttttgctgatgagaggttgagttctaaagttttgtattccattatggggttacctacgttgttaattattactatagattttaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  49623974 taacgttgttgagatcttttgctgatgagaggttgagttctaaagtcttgtattccattatggggttacctacgttgttaattattactatggattttaa 49623875  T
Q  119 ttggtgcagtttagtgatataaataagaattgatttgcgtgtttttgttattatatggttgtttgaggaagtaagtaatatgagttaattgacgtcaag 217  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||    
T  49623874 ttggtgcagtttagtgatataaatacgaattgatttgcgtgtttttgttattatatggttgtttgaggaagta---aatatgagttaattgacgtcaag 49623779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University