View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_low_68 (Length: 321)

Name: NF16020_low_68
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_low_68
NF16020_low_68
[»] scaffold0179 (2 HSPs)
scaffold0179 (13-110)||(33197-33294)
scaffold0179 (176-235)||(33076-33135)
[»] chr7 (1 HSPs)
chr7 (233-318)||(33563577-33563662)
[»] chr1 (1 HSPs)
chr1 (31-110)||(47289107-47289183)


Alignment Details
Target: scaffold0179 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 13 - 110
Target Start/End: Complemental strand, 33294 - 33197
Alignment:
Q  13 gagacagagtgagttggagagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag 110  Q
    |||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33294 gagacagagttagttggagagacaatgacggtgggcttcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag 33197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 176 - 235
Target Start/End: Complemental strand, 33135 - 33076
Alignment:
Q  176 ccactatggcaaatgatgccacatgggatgtgtgtagggtgtgtatggttcaaaagggat 235  Q
    |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  33135 ccactatgacaaatgatgccacatgggatgtgtgtatggtgtgtatggttcaaaagggat 33076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 233 - 318
Target Start/End: Complemental strand, 33563662 - 33563577
Alignment:
Q  233 gattataactacaagaaagaatcatgtagccattgaactgccatgataaaatggaacccaacagataataattggagccaatagca 318  Q
    ||||||||| |||||||| | || | ||||||||||||||| || ||||||||||||||||| | ||| |||||||||||| ||||    
T  33563662 gattataacgacaagaaatattcctatagccattgaactgctataataaaatggaacccaactgctaacaattggagccaacagca 33563577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 110
Target Start/End: Complemental strand, 47289183 - 47289107
Alignment:
Q  31 gagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag 110  Q
    ||||||| |||| ||||| ||||||||||| |||||||||||||||| |||| |||| ||||   |||||||||||||||    
T  47289183 gagacaaagacgatgggcttcatccccgaacttagggaaagagggatcgaactgagagcaag---ggcacaaagtttcag 47289107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University