View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_low_44 (Length: 389)

Name: NF16020_low_44
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_low_44
NF16020_low_44
[»] chr3 (2 HSPs)
chr3 (47-159)||(54301342-54301454)
chr3 (242-342)||(54301541-54301641)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 47 - 159
Target Start/End: Original strand, 54301342 - 54301454
Alignment:
Q  47 ggatgcgtgtgtacgttactgttattatatgtaaatatgtaatcaaccaaaaaagatactagtattggatacgaacaggagcaagtaacggcgataaagg 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54301342 ggatgcgtgtgtacgttactgttattatatgtaaatatgtaatcaaccaaaaaagatactagtattggatacgaacaggagcaagtaacggcgataaagg 54301441  T
Q  147 gaacgaacggaac 159  Q
    |||||||||||||    
T  54301442 gaacgaacggaac 54301454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 242 - 342
Target Start/End: Original strand, 54301541 - 54301641
Alignment:
Q  242 tttgagagttctcatttcttaacccaaccggacagcctgccactctggtcactgtgggcccacccacggccctctccagcccttctctttttatttattt 341  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54301541 tttgagagttctcatttcttaacccaaccggacagcctgccactctggtcactgtgggcccacccacggccctctccagcccttctctttttatttattt 54301640  T
Q  342 t 342  Q
    |    
T  54301641 t 54301641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University