View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_low_121 (Length: 237)

Name: NF16020_low_121
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_low_121
NF16020_low_121
[»] chr2 (1 HSPs)
chr2 (17-237)||(13068509-13068732)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 13068509 - 13068732
Alignment:
Q  17 gttatgtcccgtgaaacattctcattctcattctaatacatcataaccaaaaatcaaaattaattacatatcaaacacccatttacacataattacacaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13068509 gttatgtcccgtgaaacattctcattctcattctaatacatcataacaaaaaatcaaaattaattacatatcaaacacccatttacacataattacacaa 13068608  T
Q  117 gtgaac---aacaatcaatatggcaagtgcaaggagattgggcatagctatggatttctcaccatgcagcattaaggcttttcaatggacagtggataac 213  Q
    ||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13068609 gtgaacgacaacaatcaatatggcaagtgcaaggagattgggcatagctatggatttctcaccatgcagcattaaggcttttcaatggacagtggataac 13068708  T
Q  214 attgtgaaagaaggtgataacctc 237  Q
    ||||||||||||||||||||||||    
T  13068709 attgtgaaagaaggtgataacctc 13068732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University