View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_low_116 (Length: 243)

Name: NF16020_low_116
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_low_116
NF16020_low_116
[»] chr2 (3 HSPs)
chr2 (85-180)||(2372364-2372459)
chr2 (65-121)||(2371335-2371391)
chr2 (17-74)||(2372248-2372305)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 85 - 180
Target Start/End: Complemental strand, 2372459 - 2372364
Alignment:
Q  85 tttatgtgtttattattattacaggacaacgagaggaatattgtagtttatgagagaaataataataaacatagaaacaatttagtaaataataat 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||    
T  2372459 tttatgtgtttattattattacaggacaacgagaggaatattgtagtttaggagtgaaataataataaacatagaaacaatttagtaaataataat 2372364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 2371391 - 2371335
Alignment:
Q  65 tcaatttagggaaccaattgtttatgtgtttattattattacaggacaacgagagga 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2371391 tcaatttagggaaccaattgtttatgtgtttattattattacaggacaacgagagga 2371335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 74
Target Start/End: Complemental strand, 2372305 - 2372248
Alignment:
Q  17 aaactacggctaaaattttcttttttcctcttacatatgcgttggtcgtcaatttagg 74  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  2372305 aaactacggataaaattttcttttttcctcttacatatgcgttggtcgtcaatttagg 2372248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University