View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_low_105 (Length: 254)

Name: NF16020_low_105
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_low_105
NF16020_low_105
[»] chr1 (1 HSPs)
chr1 (15-218)||(3821740-3821945)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 15 - 218
Target Start/End: Original strand, 3821740 - 3821945
Alignment:
Q  15 atgaaatcaaaaaggaaaatgcaaatagaatgaatctatgctgcttttgattgtcttcccatgttctgtggattaagtttcattagtag-nnnnnnnnnn 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||               
T  3821740 atgaaatcaaaaaggaaaatgcaaatagaatgaatctatgctgcttttgattgtcttcccatgttctgtggattaagtttcattagtagtttttttttat 3821839  T
Q  114 nnnnataaaattcatctagtttagtttgattgattga-aannnnnnnnagcatagtgcaaaaacactaaccaaaagaaaatatggtagaaaaccacttct 212  Q
        |||||||||||||||| |||||||||||||||| |         ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3821840 ttttataaaattcatctagtatagtttgattgattgacatttttttttagcatagtgcaaaaacactaaccaaaagaaaatatggtagaaaaccacttct 3821939  T
Q  213 tgttga 218  Q
    ||||||    
T  3821940 tgttga 3821945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University