View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1601_high_5 (Length: 265)

Name: NF1601_high_5
Description: NF1601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1601_high_5
NF1601_high_5
[»] chr4 (2 HSPs)
chr4 (117-249)||(9601428-9601560)
chr4 (125-228)||(9605032-9605135)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 117 - 249
Target Start/End: Complemental strand, 9601560 - 9601428
Alignment:
Q  117 tattaggcaactttccatgatgctcagttatttattgtcacttgtttgtgccgtttgttagccataaatgaggacacctttaatgatagaaaatggcatg 216  Q
    ||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9601560 tattaagcaactttccatgatgctcagttatttattgttacttgttggtgccgtttgttagccataaatgaggacacctttaatgatagaaaatggcatg 9601461  T
Q  217 tttgattgtgcattcatcctttgattactagca 249  Q
    |||| ||||||||||||||||||||||||||||    
T  9601460 tttggttgtgcattcatcctttgattactagca 9601428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 125 - 228
Target Start/End: Complemental strand, 9605135 - 9605032
Alignment:
Q  125 aactttccatgatgctcagttatttattgtcacttgtttgtgccgtttgttagccataaatgaggacacctttaatgatagaaaatggcatgtttgattg 224  Q
    ||||| |||||||||||||||||||||||| || |||| ||||||||||| | ||| |||||| | ||||||||||||||||||||  |||||||| |||    
T  9605135 aacttcccatgatgctcagttatttattgttacatgttggtgccgtttgtaatccaaaaatgatgtcacctttaatgatagaaaatatcatgtttggttg 9605036  T
Q  225 tgca 228  Q
    ||||    
T  9605035 tgca 9605032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University