View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16019_low_20 (Length: 225)

Name: NF16019_low_20
Description: NF16019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16019_low_20
NF16019_low_20
[»] chr5 (1 HSPs)
chr5 (13-206)||(39629043-39629236)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 39629236 - 39629043
Alignment:
Q  13 agatgaataatttaaaacaagaaattgaaggctataaatgcgatggctagtgataattgacgaaaataaacgagcgtagaccaaaaagagattaaatcat 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  39629236 agatgaataatttaaaacaagaaattgaaggctataaatgcgatggctagtgataattgacgaaaataaacgagtgtagaccaaaaagagattaaatcat 39629137  T
Q  113 gtaggcttatataattagtggttaacatggagggctcattaattgattgaaattgacagaataatgtcaatggtgagtgattatttcattcatt 206  Q
    ||||||| ||||||||||||||||||  |||||||||| ||||||||||||||||| ||||||||||||| || ||||||||||||||||||||    
T  39629136 gtaggctcatataattagtggttaacgaggagggctcaataattgattgaaattgaaagaataatgtcaaaggagagtgattatttcattcatt 39629043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University