View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16016_low_25 (Length: 214)

Name: NF16016_low_25
Description: NF16016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16016_low_25
NF16016_low_25
[»] chr3 (1 HSPs)
chr3 (16-196)||(55058083-55058258)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 55058083 - 55058258
Alignment:
Q  16 atgaatgtggtcgaggggctttctgtgtttttatattgcaagagtatataaaatagtcaatagctttgctttgcaataaaaaaccaatctgttagtctcg 115  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||     
T  55058083 atgaatgtggtcaaggggctttctgtgtttttatattgcaagagtatataaaatagtcaatagctgtgctttgcaataaaaaaccaatctgttggtctc- 55058181  T
Q  116 tttggtttggttaatactagcagtgctcaannnnnnngaaaaagcagttatcataattactcgaaaattcgtagttattat 196  Q
        |||||||||||||| |||||||||||       ||| ||||||||||||||||||||||||||||||||||||||||    
T  55058182 ----gtttggttaatactggcagtgctcaatttttttgaagaagcagttatcataattactcgaaaattcgtagttattat 55058258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University