View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16012_low_6 (Length: 296)

Name: NF16012_low_6
Description: NF16012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16012_low_6
NF16012_low_6
[»] chr6 (1 HSPs)
chr6 (9-296)||(3838870-3839156)


Alignment Details
Target: chr6 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 9 - 296
Target Start/End: Complemental strand, 3839156 - 3838870
Alignment:
Q  9 gacatcatctaattcagcagtgaaggcagtagagcagtccggaatgttctcagcaaaacacccatgacagtgttaattggattcttaaccagtgcaccat 108  Q
    |||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  3839156 gacagcatataattcagcagtgaaggcagtagagcagtccagaatgttctcagcaaaacacccatggcagtgttaattggattcttaaccagtgcaccat 3839057  T
Q  109 cagtgttaaccttgagccagtgaaaattggggggattccaaatcacttctttttatcacaggagcccttggagggtgaatgtttatgttgaaggctttga 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  3839056 cagtgttaaccttgagccagtgaaaattggggggattccaaatcacttctttt-atcacaggagcccttggagggtgaatgtttatgttgaaggctttga 3838958  T
Q  209 ggaaaacaaattcagtcatattaattctagagcacagcttggtgttattacctgagatggaagtataggaaataatggaattgatagc 296  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3838957 ggaaaacaaattcagtcatattaattctagagcacagcttggtgttattacctgagatggaagtataggaaataatggaattgatagc 3838870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University