View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16012_low_13 (Length: 205)

Name: NF16012_low_13
Description: NF16012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16012_low_13
NF16012_low_13
[»] chr1 (1 HSPs)
chr1 (12-186)||(2602897-2603066)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 2603066 - 2602897
Alignment:
Q  12 tgtgtggttttgggacggatgaggtaaatgtctgtttaaacatgagggaataataatatccaaaatgtttttgcttctttctcttgataaaataaatgct 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  2603066 tgtgtggttttgggacggatgaggtaaatgtctgtttaaacatgagggaataataatatccaaaatgtttttgcttctttttcttgataaaataaatgct 2602967  T
Q  112 cttacttagcttgtgcaaggaaacgaaatacattcaatgtaaattattactactaggttagaatagaaggaaacc 186  Q
    ||||     ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||    
T  2602966 ctta-----cttgtgcaaggaaacgaaatacattcaatgtaaattattactaataggttggaatagaaggaaacc 2602897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University