View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16011_low_38 (Length: 204)

Name: NF16011_low_38
Description: NF16011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16011_low_38
NF16011_low_38
[»] chr8 (1 HSPs)
chr8 (1-189)||(43907995-43908183)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 43907995 - 43908183
Alignment:
Q  1 atatggtactatagtgaaacactgatttagtcatgaaattgtaatgattagagagtttagtcttgaaattaacgaaattctaaaatgatcctcaatcaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43907995 atatggtactatagtgaaacactgatttagtcatgaaattgtaatgattagagagtttagtcttgaaattaacgaaattctaaaatgatcctcaatcaca 43908094  T
Q  101 tttgtactttaggacttcaagactaaattgattgatccaaaaatactaattgaagatttttaatttcactcattatggtaattgatatt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43908095 tttgtactttaggacttcaagactaaattgattgatccaaaaatactaattgaagatttttaatttcactcattatggtaattgatatt 43908183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University