View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16010_high_18 (Length: 246)

Name: NF16010_high_18
Description: NF16010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16010_high_18
NF16010_high_18
[»] chr2 (1 HSPs)
chr2 (24-174)||(3590324-3590474)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 24 - 174
Target Start/End: Original strand, 3590324 - 3590474
Alignment:
Q  24 ttctttataatagttgcgagtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3590324 ttctttataatagttgcgagtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaa 3590423  T
Q  124 atttattccctaatagggacatatttgattatttttaaaaaatacatatta 174  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  3590424 atttattctctaatagggacatatttgattatttttaaaaaatacatatta 3590474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University