View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16008_high_2 (Length: 477)

Name: NF16008_high_2
Description: NF16008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16008_high_2
NF16008_high_2
[»] chr2 (2 HSPs)
chr2 (379-458)||(43428821-43428900)
chr2 (304-378)||(43428933-43429007)
[»] chr4 (1 HSPs)
chr4 (30-66)||(36661082-36661118)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 6e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 379 - 458
Target Start/End: Complemental strand, 43428900 - 43428821
Alignment:
Q  379 attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgacaaattgtaggtgtctagttatctagc 458  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  43428900 attctcgacttaaatggtgggaattttatttgttcataaacaattttaaatgagaaattgtaggtgtctagttatctagc 43428821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 304 - 378
Target Start/End: Complemental strand, 43429007 - 43428933
Alignment:
Q  304 cttcgggaggggttttcttgtaggtctggtattaagggtttcccatgcccctgttagtgttgtcatgaatttagt 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43429007 cttcgggaggggttttcttgtaggtctggtattaagggtttcccatgcccctgttagtgttgtcatgaatttagt 43428933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 36661118 - 36661082
Alignment:
Q  30 tgtcttttgtttttgggagccttcatgaatcatttag 66  Q
    ||||||||||||| ||||||||||| |||||||||||    
T  36661118 tgtcttttgttttcgggagccttcacgaatcatttag 36661082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University