View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16006_low_88 (Length: 240)

Name: NF16006_low_88
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16006_low_88
NF16006_low_88
[»] chr5 (2 HSPs)
chr5 (14-119)||(42206698-42206803)
chr5 (165-240)||(42205853-42205928)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 14 - 119
Target Start/End: Complemental strand, 42206803 - 42206698
Alignment:
Q  14 agataaaagttgattttcaatttcattacatgactggatttttatgaaattaataactatttttccataaaatatgtagtatttattttgatttactact 113  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42206803 agataaaagtagattttcaatttcattacatgactggatttttatgaaattaataactatttttccataaaatatgtagtatttattttgatttactact 42206704  T
Q  114 agctct 119  Q
    ||||||    
T  42206703 agctct 42206698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 165 - 240
Target Start/End: Complemental strand, 42205928 - 42205853
Alignment:
Q  165 ccccatgccccaaattattcaaattgaaatgctagtatgagagaaacatagagaataggggtagagatttcatgat 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42205928 ccccatgccccaaattattcaaattgaaatgctagtatgagagaaacatagagaataggggtagagatttcatgat 42205853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University