View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16006_low_68 (Length: 261)

Name: NF16006_low_68
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16006_low_68
NF16006_low_68
[»] chr6 (1 HSPs)
chr6 (213-248)||(26376980-26377015)


Alignment Details
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 213 - 248
Target Start/End: Original strand, 26376980 - 26377015
Alignment:
Q  213 gtgaacattttagatctatggcacactcatcattct 248  Q
    ||||||||||||||||||||||||||||||||||||    
T  26376980 gtgaacattttagatctatggcacactcatcattct 26377015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University